1✉ Instituto Nacional de Investigação Agrária e Veterinária, I.P. (INIAV), Oeiras, Portugal & GREEN-IT Bioresources for Sustainability, ITQB NOVA, Oeiras, Portugal.
2Secretaria Regional de Agricultura e Ambiente (SRAA), Direção Regional de Agricultura, Direção de Serviços dos Laboratórios Agrícolas e Agroalimentares (DSLAA), Laboratório de Qualidade Agrícola (LQA), Madeira, Portugal.
3Instituto Nacional de Investigação Agrária e Veterinária, I.P. (INIAV), Oeiras, Portugal.
4Instituto Nacional de Investigação Agrária e Veterinária, I.P. (INIAV), Oeiras, Portugal.
5Instituto Nacional de Investigação Agrária e Veterinária, I.P. (INIAV), Oeiras, Portugal & MED, Mediterranean Institute for Agriculture, Environment and Development and CHANGE—Global Change and Sustainability Institute, Institute for Advanced Studies and Research, Évora University, Pólo da Mitra, Ap. 94, 7006-554 Évora, Portugal.
6Instituto Nacional de Investigação Agrária e Veterinária, I.P. (INIAV), Oeiras, Portugal.
7CBGP, INRAE, CIRAD, Institut Agro, IRD, Univ Montpellier, Montpellier, France.
8CBGP, INRAE, CIRAD, Institut Agro, IRD, Univ Montpellier, Montpellier, France.
9CBGP, INRAE, CIRAD, Institut Agro, IRD, Univ Montpellier, Montpellier, France.
2023 - Volume: 63 Issue: 4 pages: 1154-1162
https://doi.org/10.24349/t82c-9sz9Alien arthropods jeopardize food supplies, endanger valued species, cause economic losses, disrupt ecosystem functions and threaten human health, with the accelerating pace of commercial and social globalization creating unprecedented opportunities for the movement and introduction of species to new areas of the world (Venette and Hutchison, 2021). Climate change can also create favourable conditions for pest movement, invasion, and establishment worldwide, as it can affect plant health and facilitate the introduction and installation of unwanted organisms (Gullino et al. 2022).
In the last decades, several species of allochthonous (non-native) spider mites of the family Tetranychidae have been introduced into Europe (Navajas et al. 2010). Species occasionally causing major damage to crops in Europe include Tetranychus evansi Baker & Pritchard on solanaceous crops, and Oligonychus perseae Tuttle, Baker & Abbatiello on avocado (for reviews see Boubou et al. 2011 and Bragard et al. 2022, respectively), while Eutetranychus spp. mites are important pests of citrus in southern mainland Portugal (Naves et al. 2021) and Spain (Ferragut et al. 2013). Moreover, new introductions continue to occur, resulting in additional alien species being established in Europe (e.g., Naves et al. 2021).
In Madeira Island eight species of spider mites have been reported until now, including alien and ubiquitous species with unknown status such as Eotetranychus lewisi (McGregor), O. perseae, T. evansi, Tetranychus ludeni Zacher and Tetranychus urticae Koch (Naves et al. 2021). Geologically, Madeira is located in the northwest sector of the African Tectonic plate (Brum da Silveira et al. 2012), being a political European territory and a Portuguese Autonomous Region. In this note we report the presence of two additional alien mites for Madeira, the Texas citrus mite Eutetranychus banksi (McGregor), and the African red mite Eutetranychus africanus (Tucker), this being the first report of E. africanus for a European country.
Collection of mites from plant material was undertaken in Madeira Island from May to October 2022. Mite sampling was performed in 50 localities, comprising 44 species (including agricultural and non-agricultural plants) of 23 plant families. Adult mites of both sexes were collected directly from leaves with a brush under a stereomicroscope or following the dipping washing method (Boller 1984), gathering mites on sieves of various sizes for observation under a stereomicroscope. Specimens were kept in 100% ethanol (molecular study) and 96% ethanol (morphological study).
Mites were cleared in lactic acid (50%) for a day and mounted in Hoyer's medium for phase contrast microscope observation.
Slides of the Laboratório de Qualidade Agrícola (LQA, Madeira) collection, containing Eutetranychus collected during 2020-2023, were also examined.
Morphological identifications were performed using the descriptions and keys of Meyer (1974, 1987) and Kamran et al. (2018) for the genus Eutetranychus.
For E. africanus, an integrative approach combining morphological and molecular data was used.
Total DNA from three individual mites (collected on Ricinus communis L. in Funchal, Madeira; Table 1) was extracted separately using the DNeasy Blood & Tissue Kit (Qiagen GmbH, Hilden, Germany) following the protocol provided by the manufacturer. The isolated DNA was directly used as a template for PCR amplification of the 18S ribosomal RNA gene using two primer sets: 1096F (5′GGTAATTCTGGAGCTAATAC3′) and 1912R (5′TTTACGGTCAGAACTAGGG3′) (Holterman et al. 2006); 18S-2F (5′TGGCCTCTGAGCCGACGATGTAT3′) and 18S-8R (5′TCTCGTTCGTTATCGGAATTAAC3′) (Matsuda et al. 2014). For a final volume of 25 μL, the PCR reaction mixture consisted of 12.5 μL of Platinum II HotStart PCR Master Mix (2X) (Thermo Fisher Scientific, Lithuania), 0.75 μL of each primer (10 μM), and 1 μL template DNA.
The PCR conditions were: (i) initial denaturation at 95 °C for 3 min; (ii) 5 cycles of denaturation at 94 °C for 30 s, annealing at 45 °C for 30 s, and extension at 68 °C for 30 s; followed by (iii) 35 cycles of denaturation at 94 °C for 30 s, annealing at 55 °C for 30 s, and extension at 68 °C for 30 s; and (iv) final extension at 68 °C for 5 min. PCR products were cleaned using EXO-SAP (Exonuclease I and FastAP Thermosensitive Alkaline Phosphatase, ThermoScientific, CA, USA) following the manufacturer's recommendations. The amplified PCR products were sequenced at the Sequencing Facility at INIAV with the same primers used for their amplification. Multiple sequence alignment was carried out using the Clustal-W program of BioEdit (Hall, 2007) and revealed no heterogeneity in the nucleotide composition of the 18S sequences for the three individuals. Thus, representative consensus sequences made from the forward and reverse sequences (999 bp and 1067 bp) were BLAST against the NCBI GenBank database to retrieve the closest accessions.
Two alien species belonging to the genus Eutetranychus were detected in Madeira: E. banksi and E. africanus. While E. banksi is already known from Portugal and Spain, the nearest country with the presence of E. africanus is Egypt (Attiah, 1967). The updated distribution map of both species is presented in Figure 1.
Neotetranychus (Eutetranychus) Banks, 1917: 177.
Type species: Tetranychus banksi McGregor, 1914: 358
The Texas citrus mite is reported from Afrotropical, Australasian, Nearctic, Neotropical, and Palearctic regions (Migeon and Dorkeld 2023). In Europe it is found in southern Portugal and Spain (Ferragut et al. 2013) (Figure 1), being one of the most important pests affecting citrus partly because of limited biological control by natural enemies and disruptions following insecticide applications (López-Olmos and Ferragut 2023).
Records: in Madeira, E. banksi was collected from several locations and in six host plants, three of which of the genus Citrus (Table 1). One of the plant hosts was Phaseolus vulgaris (Fabaceae), the common bean, which is a new host to this species (Migeon and Dorkeld 2023). The discovery of specimens collected in 2020 within the LQA collection implies that E. banksi is present in the Island for, at least, three years. Sampled plants had no significant damages visible.
Distinctive characters: females of this species are separated of closely species of the banksi-group (16 species, see Kamran et al. 2018) by having coxa II with 2 setae, members of setae e1 and f1 forming a trapezoid pattern, genua I and II bearing 4 setae, tibia III bearing 4–5 setae and tibia IV 5–6 setae (Figure 2).
Note: new species for Madeira Island; new host record on Phaseolus vulgaris.
The African red mite is reported from tropical and subtropical countries of the Afrotropical, Australasian and Oriental regions, and also in Iran and Egypt in the Palearctic region (Migeon and Dorkeld 2023). Damage to citrus and papaya has been reported in Africa (e.g. Kiptoo et al. 2022) and Asia (e.g. Ho et al. 2015).
Records: in Madeira, E. africanus was collected in four locations and four host plants (Table 1). Mites were found mainly on the upper surface of the leaves, particularly near the mid-rib, and feeding damage was observed (Figure 3).
Distinctive characters: females of this species are separated of other species of the banksi-group (16 species, see Kamran et al. 2018) by having coxa II with 2 setae, setae f1 members equally spaced or slightly more widely spaced than setae e1 members, dorsal striation between members of setae d1 and e1 forming a ''V-pattern'', dorsocentral setae c1, d1 and e1 inserted on obvious/prominent tubercles, 6 setae on tibiae II and III, 2 or 3 setae on genu III, 2 setae on genua II and IV (Figure 4).
The molecular analysis confirmed the morphological identification, with a positive identification consisting of a BLAST hit with 100% identity of an alignment length of 999 nucleotides with a reference database sequence, belonging to E. africanus (accession number AB926232) from Japan (Matsuda et al. 2014). The novel sequences obtained in this study were deposited in GenBank under the accession numbers OQ312050 and OQ411006. As misidentification of E. africanus as E. orientalis has occurred repeatedly (e.g., Ehara and Gotoh 2007), despite the two species being easily separated using the coxa II setal count (2 setae present in E. africanus vs. 1 seta in E. orientalis), our integrative approach, comparing both morphological and molecular characters to validated references, emphasizes its value in obtaining reliable identification of these species.
Note: new species for Madeira Island and second record for the west Palearctic region; new host record on Citrus medica.
There is no information on how the two alien Eutetranychus arrived in Madeira or how long they have been present, but the movement or trade of mite-infested plant material is the most likely hypothesis to explain their introduction. The climate of southern Madeira can certainly provide suitable climatic conditions for their persistence, considering the mean annual temperature of 18 °C (Mora and Vieira 2020).
Although E. africanus is mainly found in regions with tropical or sub-tropical climates (Figure 1), its presence in northern Iran suggests the ability to survive cold winters, and therefore this species may represent an additional challenge for citrus orchards of the Mediterranean basin. Precautionary measures should be applied to contain the populations in Madeira and prevent future disseminations of this alien mite, considering the damages reported on citrus, papaya, and on other crops worldwide. We also recommend that surveys should be conducted in continental Europe to check the presence of E. africanus. It is possible that this species occurs in mixed infestation with other Eutetranychus species and has been unnoticed until now.
We would like to thank Eng.º Samuel Freitas (Instituto do Vinho, do Bordado e do Artesanato da Madeira), Eng.ª Aurélia Sena and Eng.ª Graça Freitas (Direção Regional de Agricultura) for their assistance in samplings in Madeira Island. We also thank Emanuel Pereira, Duarte Sardinha, Graça Freitas, Dalila Gomes and Celestina Brazão for collecting the Eutetranychus mites of the LQA collection (Madeira).
Main funding was provided by the project EXPL/ASP-AGR/0082/2021 of the Portuguese Fundação para a Ciência e Tecnologia, with additional funding by the R&D Unit UIDB/04551/2020 GREEN-IT - Bioresources for Sustainability.

