Naves, Pedro¹ ; Nóbrega, Filomena² and Auger, Philippe³

¹✉ Instituto Nacional de Investigação Agrária e Veterinária, I.P. (INIAV), Av. da República, Quinta do Marquês, 2780-157 Oeiras, Portugal & GREEN-IT Bioresources for Sustainability, ITQB NOVA, Portugal.
²Instituto Nacional de Investigação Agrária e Veterinária, I.P. (INIAV), Av. da República, Quinta do Marquês, 2780-157 Oeiras, Portugal.
³CBGP, INRAE, CIRAD, IRD, Montpellier SupAgro, Univ Montpellier, Montpellier, France.

2021 - Volume: 61 Issue: 2 pages: 380-393

Original research

Keywords

Abstract

Introduction

The family Tetranychidae contains some of the most injurious plant-feeding mites, including several pests of agricultural importance. In Portugal, mites associated with agricultural crops have been studied for more than 60 years, initially by M. M. Carmona and subsequently by M. A. Ferreira (Ferreira 2011), whilst information on tetranychids of non-agricultural plants is scarce and irregular.

Bolland et al. (1998) listed 15 species of Tetranychidae for Portugal, while Carmona and Dias (1996) reported 19 species of spider mites for mainland Portugal, the Azores and Madeira archipelagos (referred as ''Portugal'' for the remainder of this paper), with two additional species [Tetranychus hydrangeae Pritchard & Baker 1955 and Tetranychus cinnabarinus (Boisduval 1867)] which are currently synonyms of Tetranychus kanzawai Kishida 1927 and Tetranychus urticae Koch 1835, respectively. Subsequent manuscripts, book chapters, academic theses and meeting abstracts were mainly published in national publications with limited distribution, making the information on the Portuguese tetranychid fauna difficult to access for international researchers. Consequently, this knowledge has been poorly disseminated, so that some species known to be present for Portugal are not recorded in international reference taxonomic databases, such as Spider Mites Web (Migeon and Dorkeld 2020) and Fauna Europaea (Bolland 2020).

Our objective is to complete the information on the diversity of Tetranychidae mites in Portugal, by compiling an updated list of the species known to occur in the country and synthesizing the most relevant information on their national distribution, main hosts, and damages. These data are reinforced by new regional and national records of recently collected spider mite species.

Material and methods

To register all the species of mites known to occur in Portugal (including the mainland, the Azores and Madeira archipelagos), we gathered available information from national and international published records, including research produced outside the traditional publishing and distribution channels such as reports, academic theses, national and regional meetings and conferences, and government documents.

We also consulted the Acarological collection of the Instituto Nacional de Investigação Agrária e Veterinária (INIAV, former Estação Agronómica Nacional), the most important national collection which comprises more than 9000 samples of phytophagous and predatory mites, collected uninterrupted since 1959 from cultivated and spontaneous plants (Ferreira 2011). In addition, mites recently collected by the senior author (PN) over a three-year period (2018-2020) in several locations in mainland Portugal, were also included in this assessment, when considered relevant.

For the nine Islands of the Azores archipelago, we used the following abbreviations: COR – Corvo; FLO – Flores; FAI – Faial; PIC – Pico; GRA – Graciosa; SJG – São Jorge; TER – Terceira; SMG – São Miguel, and SMR – Santa Maria.

The morphological identification of Eotetranychus lewisi (McGregor) was complemented with molecular analyses. Total DNA from the whole body of six individuals (four females and two males, kept in alcohol 70%) was extracted using the DNeasy Blood & Tissue Kit (Qiagen, Hilden, Germany) and two genomic regions were polymerase chain reaction (PCR) amplified and sequenced: the complete segment of the second internal transcribed spacer (ITS2) region of nuclear ribosomal DNA and a partial region of the cytochrome c oxidase subunit I (COI) gene of mitochondrial DNA. Primers ITS2-F (5'GTCACATCTGTCTGAGAGTTGAGA3') and the degenerate ITS2-R (5'GTARCCTCACCTRMTCTGAGATC3') (Ben David et al. 2007; Mirza et al. 2020) and primers COI-F (5'TTYGAYCCWAGAGGAGGAGG3') and COI-R (5'AAACCTARAAAATGTTGWGG3') (Matsuda et al. 2013) were used for the PCR. PCR reactions were performed in a 50 µl final volume using the AccuStart II Taq DNA Polymerase kit (Quanta Biosciences) and the PCR cycling conditions as reported previously by Mirza et al. (2020). PCR products were cleaned with ExoSAP reagent (Thermo Fisher Scientific) and directly sequenced in both directions using the same primers at INIAV Sequencing Laboratory (Lisbon, Portugal) on a DNA analyser ABI PRISM 3730xl (Applied Biosystems). Sequences were compared with those available in the GenBank database using the BLAST homology search.

For the taxonomic nomenclature of plants, we followed the criteria of Flora Iberica (Castroviejo, 2012).

Results

Overall, we record 28 spider mite species for Portugal, including nine Bryobiinae and 19 Tetranychinae (Table 1).

We present and discuss the species alphabetically by subfamily, tribe, genus, and species, reviewing their distribution, most important host plants and damage potential, and reporting new mite-plant associations, when applicable. An exhaustive list of bibliographic references for all species is provided in Table 1, while in the text are mentioned only the references considered most relevant.

Bryobiinae Berlese, 1913

The Bryobiinae is represented by five genera and nine species in mainland Portugal, with two species in Madeira Island and none from the Azores archipelago (Table 1).

Tribe Bryobiini Berlese, 1913

Genus Bryobia Koch, 1936

Bryobia kissophila Eyndhoven, 1955

Bryobia kissophila has only one record from southern Portugal (Algarve) on Hedera helix, in a general study of intraspecific clonal diversity of populations from Europe and other continents (Ros et al. 2008) and has not been recorded subsequently.

Bryobia praetiosa Koch, 1836

The polyphagous B. praetiosa has been collected on numerous plant species of several families, including weed plants in greenhouses, at different locations (Carmona 1970; Pina et al. 2012). This is a common species in the INIAV acarological collection, having been collected on new host plant species which are presented in Table 1.

Bryobia rubrioculus (Scheuten, 1857)

First reported in Portugal in 1960, B. rubrioculus is quite polyphagous and has been found associated with Pyrus and Malus cultivars (Carmona 1960), Ulmus sp. (Carmona and Dias 1980), and occasionally with blackberry (Rubus ulmifolius), but without damaging the plants (Ferreira 2016a). Sobreiro (1993), considered B. rubrioculus one of the most important pest mites in pear orchards, but other authors reported a significant decline of its populations since the 1960s, when it was more abundant and occasionally caused damage to fruit orchards (Carmona and Dias 1980; Carmona 1992). B. rubrioculus is also reported from Madeira Island on Ficus sp. (Carmona 1992) and is found in the INIAV acarological collection.

Bryobia ulicis Eyndhoven, 1959

Bryobia ulicis was reported by Eyndhoven and Vacante (1985) from several locations in southern Portugal on Ulex europaeus. Nevertheless, the host reported by these authors is probably incorrect because U. europaeus does not occur on or near the locations where the mites were collected (Flora-On 2020), whilst other native Ulex species are common and widespread in the collection regions mentioned by the authors. There are no records of this species in the INIAV acarological collection, but in 2019 we collected two females on U. europaeus in the centre of Portugal (Table 2), suggesting more widespread national distribution.

Tribe Hystrichonychini Pritchard and Baker, 1955

Genus Aplonobia Womersley, 1940

Aplonobia histricina (Berlese, 1910)

This species was reported on the catalogue of Carmona and Dias (1996), collected in the Algarve, southern Portugal, this being the sole record on the INIAV acarological collection. Nevertheless, recent samplings by the first author revealed A. histricina to be common in urban and peri-urban areas in Lisbon District, in association with Oxalis pes-caprae (Table 2). The Portuguese record is the second for Europe, after a previous one from Italy (Migeon and Dorkeld 2020).

Genus Tetranycopsis Canestrini, 1889

Tetranycopsis horridus (Canestrini & Fanzago, 1876)

Tetranycopsis horridus is the unique species of this genus present on the mainland and was reported from northern Portugal on hazel (Corylus avellana), without causing significant damage (Carmona and Dias 1996). It is present in the INIAV acarological collection.

Genus Schizonobia Womersley, 1940

Schizonobia sycophanta Womersley, 1940

Schizonobia sycophanta has a restricted distribution in the Palearctic, having previously only been reported from the Netherlands (Migeon and Dorkeld 2020). In Portugal, it was collected on Echium plantagineum growing in vineyards in the Setúbal region (Santos 2011). Furthermore, in the INIAV collection there are specimens collected from leaves and trunk of Vitis vinifera in different locations of southern Portugal, and from Conyza sumatrensis (labelled as C. albida), which are new hosts for this mite (Table 1).

Tribe Petrobiini Reck, 1952

Genus Petrobia Murray, 1877

Petrobia (Petrobia) apicalis Banks, 1917

Petrobia (Petrobia) apicalis is a probable exotic of Nearctic origin and was reported by Carmona (1970) on unidentified Poaceae weeds in Cascais, near Lisbon, with the slides included in the INIAV acarological collection. The species has not been reported subsequently.

Petrobia (Tetranychina) harti (Ewing, 1909)

The oxalis spider mite, P. (Tetranychina) harti, appears to be common and widespread on the mainland, associated mainly with different Oxalis species, but also with Pennisetum longistylum, Citrus grandis and strawberries (Fragaria spp.) (Carmona 1970; Carmona and Dias 1980), being also common on weeds in greenhouses (Pina et al. 2012). The INIAV collection contains several specimens, mostly collected from Oxalis corniculata but also from Digitaria sanguinalis, which is a new host for this mite (Table 1). The oxalis spider mite is also reported from Madeira Island, on O. pes-caprae (Carmona, 1973a).

Tetranychinae Berlese, 1913

The Tetranychinae includes nine genera and 19 species on mainland Portugal, with six species on Madeira Island and four on the Azores archipelago (Table 1).

Tribe Eurytetranychini Reck, 1950

Genus Eurytetranychus Oudemans, 1931

Eurytetranychus buxi (Garman, 1935)

This species has been found on Buxus sempervirens in the mainland (Carmona and Dias 1980), being present in the INIAV collection. Despite the absence of additional published records, this mite was recently found by the first author in public and private gardens in the centre and south of mainland Portugal, along with its host plant (Table 2).

Genus Eutetranychus Banks, 1917

Eutetranychus banksi (McGregor, 1914)

This exotic species is known as the Texas citrus mite and was reported in the Algarve region (southern Portugal) in 1999 causing significant damage to citrus (Carvalho et al. 1999). It is considered a local key-pest by citrus farmers (Gonçalves et al. 2002) and is very abundant in citrus orchards in southern Portugal (Naves, personal observations). It is frequent in the INIAV acarological collection, mainly reported from Citrus and occasionally from almond, Prunus dulcis, in southern Portugal.

Tribe Tetranychini Reck, 1950

Genus Amphitetranychus Oudemans, 1931

Amphitetranychus viennensis (Zacher, 1920)

The polyphagous and globally widespread species, A. viennensis, was first reported by Carmona in 1964 (as Tetranychus viennensis) on Malus sylvestris, Prunus persica, Pyrus communis, and subsequently on other Rosaceae (Carmona and Dias 1980). Despite being considered an important pest in apple orchards (Sobreiro 1993), its populations have been systematically declining since the 1960s (Carmona and Dias 1980), and less than 1% of peach (P. persica) orchards were infested in a study conducted in the south and centre of Portugal (Ferreira and Carmona 1997). A. viennensis is, consequently, represented by a small number of specimens in the INIAV acarological collection.

Genus Eotetranychus Oudemans, 1931

Eotetranychus coryli Reck, 1950

Eotetranychus coryli was reported from several locations in mainland Portugal in 1966 (Carmona 1966), this being one of the first reports in Europe. Its main host is Corylus avellana (Carmona 1966; Carmona and Dias 1980), although it has also been collected on Castanea sativa, M. sylvestris and Prunus domestica in north-eastern Portugal (Carmona 1966), the last two plant species being new hosts for this mite (Table 1). Present in the INIAV collection.

Eotetranychus lewisi (McGregor, 1943)

The Lewis spider mite, E. lewisi was reported by Carmona (1992) on plants of poinsettia Euphorbia pulcherrima and on Vitis sp. in Funchal, Madeira Island, included in the INIAV collection. After this finding there are few additional references to this species in Madeira, but from 2017 onwards E. lewisi was again detected in poinsettia plants growing wild and in gardens (EPPO, 2020).

The Lewis spider mite is regulated as an A1 quarantine pest for the EU (Annex II - Part A: Pests not known to occur in the Union territory) (EU 2019) and has the potential to establish in large parts of the EU territory (EFSA 2017). In Europe, E. lewisi has been reported from Norway, Germany, the UK (EFSA 2017) and Poland (Labanowski 2009), mostly from imported plants kept in glasshouses, but it was successfully eradicated in all the outbreaks (EFSA 2017). A new outbreak was recently reported from nurseries producing poinsettias under greenhouses in Germany, with eradication ongoing (EPPO, 2020).

In continental Portugal, the Lewis spider mite was recently identified from samples collected by the national plant health authority, DGAV - Direção-Geral de Alimentação e Veterinária, in two localities in the Algarve District (Portimão and Loulé county), in 2019 and 2020. Identified specimens were found on leaves of E. pulcherrima grown in gardens, confirming high preference for this plant host (Andrews and Poe 1980; Goff 1986; Carmona 1992; Ho and Shih 2004; Ho 2007). Examined leaves of E. pulcherrima contained abundant numbers of eggs, immature stages and adults of both sexes, this being the first record for mainland Portugal and continental Europe of an established population in outdoor conditions.

Molecular analysis endorsed the morphological identification: BLAST analysis of the sequences of ITS2 region (447 bp) were 99,76% and 99,55% identical to the only two E. lewisi sequences (JF774172 and EU007694, respectively) available in the GenBank. The new sequences were deposited to GenBank database (NCBI) under the accession numbers MW524100 to MW524105. For the COI region (530 bp), the BLAST analysis showed that this primer combination amplified mtDNA of the mite, but in the absence of COI region sequences for this species in the GenBank, it is not possible to determine homology. The sequences were deposited to GenBank database (NCBI) under the accession numbers MW538643 to MW538648. Voucher specimens mounted in slides are deposited in the INIAV acarological collection, reference numbers SV-19-00673, SV-19-02071 and SV-20-01735.

Eotetranychus rubiphilus Reck, 1948

Eotetranychus rubiphilus was reported in 2011 on blackberries (Rubus sp.) in a greenhouse in Odemira, southern Portugal (Pina et al. 2012), causing damage mainly to the Karaka Black cultivar (Ferreira et al. 2015). In the INIAV collection, there are specimens collected during the last decade on several Rubus species, which are new hosts for this mite (Table 1). It is the most important phytophagous mite affecting blackberries, particularly in greenhouses, although it has not been found on some species, such as Rubus sampaioanus (Ferreira, 2016a). Additionally, E. rubiphilus has been collected in Odemira (Beja District) on V. vinifera, supporting the suggestion of Migeon et al. (2007) that its occurrence on grapevines could be more widespread than assumed previously.

Eotetranychus tiliarium (Hermann, 1804)

Eotetranychus tiliarium is here reported for the first time for continental Portugal and was collected in 2019 on young and adult lime (Tilia sp.) trees in the city of Lisbon (Table 2). Moreover, slides of this species collected on Tilia sp. in Guimarães (northern Portugal) were present in the INIAV acarological collection since 2010, suggesting a more widespread national distribution of this mite.

Genus Oligonychus Berlese, 1886

Oligonychus bicolor (Banks, 1894)

In Portugal, O. bicolor is mainly associated with oaks (Quercus spp.) (Carmona and Dias, 1980; 1996), but also occasionally found on chestnut (C. sativa) in the North and centre of the mainland, without causing damage (Carmona and Dias 1996). It is present in the INIAV acarological collection.

Oligonychus perseae Tuttle, Baker & Abbatiello, 1976

The Persea mite, O. perseae, was detected on Madeira Island in 2005 associated with avocado (Persea americana), grapes (V. vinifera), European plum (P. domestica) and the ornamentals Wisteria sinensis and Bauhinia variegata (Ferreira et al. 2006). In 2006, it was found in the Algarve (mainland Portugal), associated mainly with avocado (Hass, Reed and Bacon cultivars), but also with carob trees (Ceratonia siliqua), Sweet cherry (Prunus avium), Persimmon (Diospyros kaki), common Walnut (Juglans regia) and grapes (Ferreira et al. 2007), being included in the INIAV collection. In 2020, O. perseae was found causing significant damage to avocado in the Óbidos region, centre Portugal, suggesting a significant northern extension of its known distribution range.

Genus Panonychus Yokoyama, 1929

Panonychus citri (McGregor, 1916)

The citrus red mite, P. citri, was detected in 1984 on the mainland with widespread and abundant populations on citrus, a few years after its detection in neighbouring Spain (Maltez 1985). This species is more common in the centre and south of continental Portugal (Ferreira and Carmona 1990; Carmona and Dias 1996; Pereira et al. 2006), usually near the coast, where its hosts are more often planted, and temperatures are not so extreme. It is also a common species in the Azores (Costa-Comelles et al. 1993), where it was found on four Islands - FAI, PIC, TER and SMG (Borges et al. 2010). There are several slides in the INIAV acarological collection.

Panonychus ulmi (Koch, 1836)

The European red mite, P. ulmi, is widespread and abundant on mainland Portugal (Carmona 1960; Carvalho 1971; Amaro 1980), on Madeira island (Carmona 1973a; Carmona and Dias 1996) and on the Azorean Islands of PIC and TER (Borges et al. 2010).

It is considered the most important phytophagous mite on fruit orchards and a key-pest of apple (and occasionally pear) agrosystems in the mainland (Amaro 1980; Carmona and Dias 1980; Maltez and Carmona 1980; Sobreiro 1993; Espinha et al. 1999; Costa 2006) and the Azores (Lopes et al. 2009). Damage has also been reported on grapes (Carmona 1973b; Carmona and Dias 1980; Carmona and Ferreira 1989) and occasionally on beans (Ferreira and Carmona 1994) and tomato (Neves 2012), with up to nine (Maltez 1994) or ten (Sobreiro 1993) annual generations possible. It is frequent in the INIAV acarological collection.

Genus Schizotetranychus Trägrådh, 1915

Schizotetranychus asparagi (Oudemans, 1928)

This species was reported on the mainland on the ornamental fern, Asparagus setaceus, and on Asparagus officinalis (Carmona 1970; Carmona and Dias 1980), with the slides included in the INIAV acarological collection. There are no additional recent reports.

Genus Stigmaeopsis Banks, 1917

Stigmaeopsis nanjingensis (Ma & Yuan, 1980)

This species is a new record for the Portuguese tetranychid fauna. It was detected in public gardens on Phyllostachys nigra in Lisbon, and on Phyllostachys sp. in Oeiras and Viseu (Table 2), suggesting a widespread national distribution on its bamboo hosts, which are popular ornamental plants in private and public gardens. Populations were abundant and protected by a dense web nest on the under surface of the leaves, causing conspicuous whitish-yellow spots on the upper side of leaves and negatively affecting the aesthetic value of the plants.

Genus Tetranychus Dufour, 1832

Tetranychus evansi Baker & Pritchard, 1960

The tomato spider mite, T. evansi, is an important pest of solanaceous crops and was detected in continental Portugal in 1991 (the first report in Europe), 60 km northeast of Lisbon and causing severe damage to tomato (Ferreira and Carmona 1995). A few years later, it was again reported as a new addition to the Portuguese tetranychid fauna by Bolland and Vala (2000). The tomato spider mite is now widespread from Minho to the Algarve, being more frequent in the centre and south of the mainland except for mountainous interior regions where low temperatures during winter seem to limit its presence. It is also found on Madeira Island (Migeon et al. 2009; Ferreira and Sousa 2011). This polyphagous mite has been found locally, associated with 39 different plant species belonging to 14 families, in particular to Asteraceae and Solanaceae (Ferreira and Sousa 2011). Its most important local cultivated host is tomato (Solanum lycopersicum), on which severe damage was observed (Carmona and Dias 1996). The widespread black nightshade, Solanum nigrum, is a common wild host for this mite (Ferreira and Sousa 2011; Santos 2011), and many specimens collected from this plant are present in the INIAV acarological collection.

Tetranychus kanzawai Kishida, 1927

Another exotic species, the Kanzawa spider mite, T. kanzawai, was reported in 1994 by Ferreira and Carmona (as T. hydrangeae), being more common in the north and centre of the country, where it is mostly associated with bean (Phaseolus spp.) (Carmona and Dias 1996). There is one record of this species on Mentha suaveolens, a new host plant, in the INIAV acarological collection (Table 1).

Tetranychus lintearius Dufour, 1832

Tetranychus lintearius is a specialist of the genus Ulex (Fabaceae) and has been locally reported from U. europaeus (Ireson et al. 2003; Norambuena et al. 2007). Despite being absent from the INIAV acarological collection, this mite is quite common and widespread in mainland Portugal. In the last three years, it has been found associated with U. europaeus, Ulex minor, and other new Ulex host species: Ulex airensis, Ulex australis, and Ulex densus (Tables 1 and 2).

Tetranychus ludeni Zacher, 1913

The red mite, T. ludeni, is widespread in the centre and south of mainland Portugal (Carmona 1960; Carmona and Dias 1980). It is also common on the Azores archipelago, namely on FAI, PIC and SMG (Costa-Comelles et al. 1993; Borges et al. 2010), and on Madeira Island, where it attacks local banana plantations causing damage to the fruits (Carmona 1992; Carmona and Dias 1996). This polyphagous mite can be found on several important agricultural crops, but particularly on bean, P. vulgaris (Carmona and Dias 1980; Ferreira and Carmona 1994). Specimens of T. ludeni are very frequent in the INIAV acarological collection, with new plant hosts presented in Table 1.

Tetranychus turkestani (Ugarov & Nikolskii, 1937)

The strawberry spider mite, T. turkestani, is a major pest of crops and has been found on cultivated and non-cultivated plants (Carmona 1964; Carmona and Dias 1980), including tomato (Ferreira and Carmona, 1995), strawberries (Fragaria spp.) and corn (Zea mays) (Carmona and Dias 1980, as T. atlanticus; Pereira 2004), but also in vineyards and on fruit trees. In the INIAV acarological collection there are additional samples from weeds in agricultural fields, including new hosts for this species (Table 1). It is present all over the mainland and appears to be more frequent in the north and centre (Carmona and Dias 1996).

Tetranychus urticae Koch, 1835

The two-spotted spider mite, T. urticae, particularly the red form formerly known as T. cinnabarinus (Auger et al. 2013) and T. telarius (Smith and Baker, 1968) is locally widespread and quite common (Carmona 1960; 1973a; Carmona and Dias 1980; Ferreira 1980; Ferreira and Carmona 1995). The mite is present all over the mainland (Carmona and Dias 1980), and also found on Madeira (Carmona 1973a; Carmona and Dias 1996) and on three Azorean Islands (FAI, TER and SMG) (Costa-Comelles et al. 1993; Borges et al. 2010).

The two-spotted spider mite is associated with a wide range of hosts, including wild and ornamental plants and agricultural crops, being quite common on grapes and fruit trees, where it causes damage (Carmona 1988; Carmona and Ferreira 1989; Sobreiro 1993; Carmona and Dias 1996; Brites et al. 2019). Other common hosts include bean (Ferreira 1980; Ferreira and Carmona 1994), corn (Pereira 2004), tomato (Ferreira and Carmona 1995) and raspberries (Rubus idaeus), particularly in greenhouses (Ferreira 2016b). The number of annual generations varies from six to twelve, according to the region and local climatic conditions (Rodrigues 2012). According to Neves (2012), populations usually increase after application of wide-spectrum pesticides, which probably disrupt natural control by predatory phytoseiid mites (Rodrigues 2012). It is the most common species in the INIAV acarological collection, associated with multiple plant hosts but mainly with tomato, strawberry, and vineyards.

Discussion

Overall, we compiled a total of 28 species of tetranychids for the Portuguese fauna, including several species which have been previously reported but are generally overlooked in international taxonomic databases (A. histricina, E. rubiphilus, O. perseae, P. citri, S. sycophanta, T. horridus, T. kanzawai), two species which constitute new national records (E. tiliarium, S. nanjingensis) and one new record for the mainland (E. lewisi). Four and eight species occur on the Azores archipelago and Madeira Island, respectively. Spider mites have not been reported from Porto Santo, the second inhabited Island of the Madeira Archipelago and this could be due to the absence of sampling and/or to lower availability of suitable host plants in the small, semi-desert ecosystem on the island.

The number of tetranychid mites recorded from Portugal is not remarkably high when comparing with other European countries with similar dimensions, with 37 species recorded for Hungary (Kontschan and Ripka 2017) and 44 for Serbia (Marić et al. 2018, 2021), which probably reflects the differences in the dominant vegetation communities, in sampling effort, and in the number of local taxonomic specialists.

It is worth noting the considerable component of non-indigenous species (at least six species, with A. histricina, P. apicalis and P. citri also of probable exotic origin), which correspond to 21% of the tetranychid fauna and highlight the ease with which spider mites are transported and introduced in international trade of mite-infested agricultural and ornamental plants (Navajas et al. 2010). The Mediterranean climate prevailing in most of mainland Portugal provides suitable climatic conditions for plant and mite species of temperate climates, but also for the establishment of species of tropical or sub-tropical origin, such as the recently detected S. nanjingensis and E. lewisi, among others.

Some species are locally important agricultural pests, namely E. banksi and P. citri on citrus, P. ulmi on fruit orchards, T. evansi on tomato and T. urticae mainly on grapes, tomato, and strawberries, while E. rubiphilus and O. perseae also exhibit high populations on their main hosts. The recently detected Lewis mite, E. lewisi, is a polyphagous pest which can attack several economically important crops in Portugal and in the EU, including Citrus, Carica, Euphorbia, Fragaria, Ficus, Olea, Prunus, Rubus and Vitis (EFSA 2017; EPPO 2021), and should be monitored as a potentially harmful species with its distribution, population levels, main hosts, possible impact, and damages to crops evaluated.

Mite sampling and published studies in Portugal are historically biased towards the species of highest agricultural importance, particularly of the genera Eotetranychus, Oligonychus, Panonychus and Tetranychus, whilst most species affecting non-cultivated plants are known from isolated or infrequent records and have not been regularly collected/reported, including A. histricina, B. ulicis, B. kissophila, P. apicalis, T. lintearius and S. asparagi. Nevertheless, this does not necessarily mean they are rare or have restricted distributions, considering the examples of A. histricina, B. ulicis, E. buxi and T. lintearius with few records but recently found to be abundant and/or widespread.

It would be interesting to evaluate the presence and impact of E. buxi on wild specimens of its host, B. sempervirens, which has small and confined natural populations on river gorges and rocky ravines in northern Portugal, being classified as a nationally endangered species (Carapeto et al. 2020). Additional sampling of wild vegetation, particularly plant species having limited geographical distribution, may reveal the presence of other tetranychids, particularly Bryobiinae. Furthermore, a few species present in neighbouring Spain, such as Eutetranychus orientalis (Klein 1936), Eotetranychus carpini (Oudemans, 1905), Eotetranychus aceri Reck, 1948, Oligonychus ununguis (Jacobi 1905) and Neotetranychus rubi Trägårdh 1915 (Migeon and Dorkeld 2020), may be expected to be detected in the future, considering their current distribution and the availability and abundance of their plant hosts in Portugal.

Acknowledgements

We would like to thank the Portuguese NPPO, Direção-Geral de Alimentação e Veterinária (DGAV), in the person of Engº Nuno Barbosa, for providing data on the location and host of E. lewisi in continental Portugal. Thanks also to Marina Cardoso and Márcia Santos (INIAV) for assistance in obtaining bibliographic references. We also want to acknowledge Dr. Hugh Evans (Forestry Commission, UK) for reviewing the English language, and to three anonymous reviewers for the useful comments and suggestions. Work was partially funded by Fundação para a Ciência e a Tecnologia through the R&D Unit UIDB/04551/2020 GREEN-IT - Bioresources for Sustainability.

References

1. Amaro P. 1980. A luta integrada no combate aos ácaros fitófagos da macieira. In: Actas do I Congresso Português de Fitiatria e Fitofarmacologia, Lisboa. p. 43-58.
2. Andrews K.L., Poe S.L. 1980. Spider mites of El Salvador, Central America (Acari: Tetranychidae). Florida Entomologist, 63: 502-505. doi:10.2307/3494536
3. Auger P., Migeon A., Ueckermann E.A., Tiedt L., Navajas M. 2013. Evidence for synonymy be-tween Tetranychus urticae and Tetranychus cinnabarinus (Acari, Prostigmata, Tetranychi-dae): review and new data. Acarologia, 53: 383-415. doi:10.1051/acarologia/20132102
4. Ben-David T., Melamed S., Gerson U., Morin S. 2007. ITS2 sequences as barcodes for identify-ing and analyzing spider mites (Acari: Tetranychidae). Experimental and Applied Acarology 41: 169-181. doi:10.1007/s10493-007-9058-1
5. Bolland, H.R. 2020. Fauna Europaea: Tetranychidae (Internet). (05 December 2020). In: Magowski, W (2020) Fauna Europaea: Prostigmata. Fauna Europaea version 2017.06. Available from: https://fauna-eu.org .
6. Bolland H.R., Gutierrez J., Flechtmann, C.H.W. 1998. World catalogue of the spider mite family (Acari: Tetranychidae). Leiden: Brill Academic Publishers. pp. 392.
7. Bolland H.R., Vala F. 2000. First record of the spider mite Tetranychus evansi (Acari: Tetranychidae) from Portugal. Entomologische Berichten, 60: 180.
8. Borges P.A., Vieira V., Amorim I.R., Bicudo N., Fritzén N., Gaspar C., Heleno R., Hortal J., Lissner J., Logunov D., Machado A., Marcelino J., Meijer S.S., Melo C., Mendonça E.P., Moniz J., Pereira F., Santos A.S., Simões A.M., Torrão E. 2010. List of arthropods (Arthropoda). In: Borges P.A., Costa A., Cunha R., Gabriel R., Gonçalves V., Martins A.F., Melo I., Parente M., Raposeiro P., Rodrigues P., Santos R.S., Silva L., Vieira P. (Eds.). A list of the terrestrial and marine biota from the Azores. Cascais (Lisboa), Principia, p. 179-246.
9. Brites C., Pires P., Flores R. 2019. Avaliação da resistência das castas mais predominantes no Alentejo ao Aranhiço Amarelo (Tetranychus urticae Koch). In: Livro de resumos do III Congresso Nacional das Escolas Superiores Agrárias, Instituto Politécnico de Viseu. p 68.
10. Carapeto A., Francisco A., Pereira P., Porto M. 2020. Lista Vermelha da Flora Vascular de Portugal Continental. In: Carapeto A., Francisco A., Pereira P., Porto M. (Eds.). Sociedade Portuguesa de Botânica, Associação Portuguesa de Ciência da Vegetação - PHYTOS e Instituto da Conservação da Natureza e das Florestas (coord.). Coleção "Botânica em Português", Volume 7. Lisboa: Imprensa Nacional, pp. 374.
11. Carmona M.M. 1960. Contribuição para o conhecimento dos ácaros das plantas cultivadas em Portugal - I. Agronomia Lusitana, 22: 221-230.
12. Carmona M.M. 1964. Contribuição para o conhecimento dos ácaros das plantas cultivadas em Portugal - III. Agronomia Lusitana, 24: 273-288.
13. Carmona M.M. 1966. Contribuição para o conhecimento dos ácaros das plantas cultivadas em Portugal - IV. Agronomia Lusitana, 26: 175-203.
14. Carmona M.M. 1970. Contribuição para o conhecimento dos ácaros das plantas cultivadas em Portugal - V. Agronomia Lusitana, 31: 137-183.
15. Carmona M.M. 1973a. Ácaros Fitófagos e Predadores da Ilha da Madeira. Agronomia Lusitana, 34: 255-281.
16. Carmona M.M. 1973b. A presença do ácaro Panonychus ulmi Koch na vinha. Agricultura, 4: 6-21.
17. Carmona M.M. 1975. Os ácaros fitófagos e a importância do seu estudo. In: Curso de atualização e extensão universitária em ciências naturais: A aplicação das ciências biológicas à defesa das culturas (Entomologia e Patologia Vegetais). Sociedade Portuguesa de Ciências Naturais, Lisboa. p. 55-65.
18. Carmona M.M. 1988. Ácaros fitófagos e indiferentes de vinhas alentejanas. In: 1.º Simpósio da Vitivinicultura do Alentejo, Évora. p. 133-145.
19. Carmona M.M. 1992. Ácaros fitofagos e predadores da Ilha da Madeira - II. Boletín Sanidad Vegetal, Plagas, 18: 469-482.
20. Carmona M.M., Dias J.S. 1980. O complexo Acarina nas culturas portuguesas. In: Actas do I Congresso Português de Fitiatria e Fitofarmacologia, Lisboa. p. 97-115.
21. Carmona M.M., Dias J.S. 1996. Fundamentos de Acarologia Agrícola. Lisboa: Fundação Calouste Gulbenkian. pp. 423.
22. Carmona M.M., Ferreira M.A.S. 1989. Acarofauna of grapevines in Portugal. In: Proceedings of the CEC/IOBC international symposium "Plant protection problems and prospects of integrated control in Viticulture", Lisboa - Vila Real, 1988. p. 225-229.
23. Carvalho J.L 1971. Algumas considerações sobre um ácaro fitófago da macieira Panonychus ulmi Koch. Revista Agronômica, Lisboa Silva, 54: 1-12.
24. Carvalho J.P., Ilharco F.A., Ferreira M.A. S., Carvalho M.P. 1999. Manual de pragas e sintomas do ataque de insectos e ácaros em citrinos. Oeiras: Estação Agronómica Nacional. pp.142.
25. Costa J. 2006. Ficha Técnica n.º 107 - O Aranhiço-vermelho em Protecção Integrada da Vinha. Direcção Regional de Entre-Douro e Minho, Ministério da Agricultura, do Desenvolvimento Rural e das Pescas. pp. 4.
26. Costa-Comelles J.C., Soares A., Schanderl H.J., Vercher, R.E., Ferragut F. 1993. A contribution to data on mite fauna in Azores islands. Faial: Relatórios e Comunicações do Departamento de Biologia da Universidade dos Açores, Faial/93, 22: 40-44.
27. Castroviejo S. 2012. Flora iberica 1-8, 10-15, 17-18, 21. Real Jardín Botánico, CSIC, Madrid.
28. EFSA PLH Panel (EFSA Panel on Plant Health), Jeger M., Bragard C., Caffier D., Candresse T., Chatzivassiliou E., Dehnen-Schmutz K., Gilioli G., Grégoire J.-C., Jaques Miret J.A., MacLeod A., Niere B., Parnell S., Potting R., Rafoss T., Rossi V., Urek G., Van Bruggen A., Van Der Werf W., West J., Winter S., Bergeretti F., Bjorklund N., Mosbach-Schulz O., Vos S., Navajas M. 2017. Scientific Opinion on the pest risk assessment of Eotetranychus lewisi for the EU territory. EFSA Journal 15 No 4878, 122 pp. doi:10.2903/j.efsa.2017.4878
29. EPPO, 2020. EPPO Reporting Service 2020 no. 11 - Paris 2020-11. pp. 25.
30. EPPO, 2021. Eotetranychus lewisi. EPPO datasheets on pests recommended for regulation. (17 February 2021). Available online at: https://gd.eppo.int .
31. Espinha I., Carlos C., Pereira J.A. 1999. Luta biológica contra o aranhiço vermelho, Panonychus ulmi (Koch) em macieira. In: Actas do Simpósio Protecção Integrada da macieira contra o aranhiço vermelho, Panonichus ulmi (Koch) em condições mediterrânicas. Universidade de Trás-os-Montes e Alto Douro, Vila Real, 7 de Junho de 1999. pp. 2.
32. E.U. 2019. EU Commission Implementing Regulation 2019/2072 of 28 November 2019 establishing uniform conditions for the implementation of Regulation (EU) 2016/2031 of the European Parliament and the Council, as regards protective measures against pests of plants, and repealing Commission Regulation (EC) No 690/2008 and amending Commission Implementing Regulation (EU) 2018/2019. Official Journal of the European Union, 10.12.2019, L 319/1. pp. 279.
33. Eyndhoven G.L.v., Vacante V. 1985. The Berlese-Group of the genus Bryobia Koch (Acari, Tetranychidae). Redia, 68: 377-437.
34. Ferreira M.A. S. 1980. Preferências alimentares do Tetranychus telarius (L.) (Acarina: Tetranychidae) em feijoeiro. In: Actas do I Congresso Português de Fitiatria e Fitofarmacologia, Lisboa: 127-135.
35. Ferreira M.A. S. 1985. Flutuação de populações de Acarina em videira. In: Actas do II Congresso Ibérico de Entomologia, Suplemento nº 1 ao Boletim da Sociedade Portuguesa de Entomologia, 2: 383-393.
36. Ferreira M.A. S. 2011. Acarofauna agrícola e florestal em Portugal. In: Coelho P., Reis P. (Eds). Agrorrural: Contributos Científicos. Lisboa: INRB e INCM, p. 883-893.
37. Ferreira M.A. S. 2016a. Acarofauna da amora em Portugal. In: Actas do V Colóquio Nacional da Produção de Pequenos Frutos, Actas Portuguesas de Horticultura nº 26: 169-176.
38. Ferreira M.A.S. 2016b. Acarofauna da framboesa em Portugal. In: Actas do V Colóquio Nacional da Produção de Pequenos Frutos, Actas Portuguesas de Horticultura nº 26: 183-186.
39. Ferreira M.A.S., Brazão C.I., Aguiar A.F. 2006. Ocorrência de Oligonychus perseae Tuttle, Baker & Abbatiello (Acari: Tetranychidae) na Ilha da Madeira. Agronomia Lusitana, 51: 219-222.
40. Ferreira M.A.S., Carmona, M.M. 1990. Acarofauna dos citrinos em Portugal. Actas de Horticultura 6 - 1.° Congresso Ibérico de Ciências Hortícolas, Lisboa, 3: 46-51.
41. Ferreira M.A.S., Carmona M.M. 1994. Acarofauna do feijoeiro em Portugal. Boletín Sanidad Vegetal, Plagas, 20: 111-118.
42. Ferreira M.A.S., Carmona M.M. 1995. Acarofauna do tomateiro em Portugal. In: Comité Editorial (Eds.). Avances en Entomología Ibérica. Madrid: Museo Nacional Ciencias Naturales (CSIC) y Universidad Autónoma de Madrid. p. 385-392.
43. Ferreira M.A.S., Carmona M.M. 1997. Acarofauna do pessegueiro em Portugal. Boletín Sanidad Vegetal, Plagas, 23: 473-478.
44. Ferreira M.A.S., Pina S., Calha I.M. 2015. Acarological diversity on blackberry crop and neighbouring vegetation in Southwestern Portugal. IOBC/WPRS Bulletin, 109: 129-137.
45. Ferreira M.A. S., Ramos N., Soares C., Fernandes J.E. 2007. O ácaro do-abacateiro no Algarve. Frutas, Legumes e Flores, 97: 56-57.
46. Ferreira M.A. S., Sousa M.E. 2011. Hosts and Distribution of the Spider Mite Tetranychus evansi (Acari: Tetranychidae) in Portugal. Acta Horticulturae, 917: 133-136. doi:10.17660/ActaHortic.2011.917.16
47. Flora-On: Flora de Portugal Interactiva. (Internet). (28 November 2020). Sociedade Portuguesa de Botânica. Available from: https://www.flora-on.pt .
48. Goff M.L. 1986. Spider mites (Acari: Tetranychidae) in the Hawaiian Islands. International Journal of Acarology, 12: 43-49. doi:10.1080/01647958608683437
49. Gonçalves M., Cavaco M., Fernandes J.E., Soares C., Ramos N. 2002. Ácaro do Texas Eutetranychus banksi (McGregor, 1914): nova espécie de ácaro na cultura dos citrinos no Algarve. Oeiras: Direção Geral de Proteção das Culturas. pp.11.
50. Ho C.C. 2007. Monitoring on two exotic spider mites in Taiwan. Applied Zoology Division, Agricultural research Institute, COA, Taichung, Taiwan, ROC. pp. 9.
51. Ho C.C., Shih S.P. 2004. Eotetranychus lewisi, a new pest of poinsettia from Taiwan. Plant Protection Bulletin (Taipei), 46: 173-176.
52. Ireson J.E., Gourlay A.H., Kwong R.M., Holloway R.J., Chatterton W.S. 2003. Host specificity, release, and establishment of the gorse spider mite, Tetranychus lintearius Dufour (Acarina: Tetranychidae), for the biological control of gorse, Ulex europaeus L. (Fabaceae), in Australia. Biological Control, 26: 117-127. doi:10.1016/S1049-9644(02)00128-7
53. Kontschan J., Ripka G. 2017. Checklist of the Hungarian spider mites and flat mites (Acari: Tetranychidae and Tenuipalpidae). Systematic and Applied Acarology, 22: 1199-1225. doi:10.11158/saa.22.8.6
54. Labanowski G. 2009. Pests of ornamental plants introduced to Polish glasshouses. Progress in Plant Protection, 49: 1714-1723.
55. Lopes D.H., Macedo N., Rodrigues R., Borges P.V., Pimentel R., Zorman M., Carvalho M.F., Ornelas L., Mumford J.D., Mexia, A.M. 2009. Monitorização dos problemas fitossanitários e fauna auxiliar presentes em pomares de macieiras da ilha Terceira. In: Actas do I Congresso de Fruticultura e Viticultura. Angra do Heroísmo, 17-19 Abril 2008. p. 84-92.
56. Maltez A.C. 1985. A presença de Panonychus citri (McGregor) em Portugal. In: Actas do II Congresso lberico de Entomologia, Vol. II: 4I7- 426.
57. Maltez A.C. 1988. Flutuação de populações de Acarina num pomar de pessegueiros. In: Actas do III Congresso Ibérico de Entomologia: pp. 855-866.
58. Maltez A.C. 1994. Evaluation of the annual number of Panonychus ulmi (Koch) (Acari: Tetranychidae) generations in apple-trees. Boletín Sanidad Vegetal, Plagas, 20: 165-172.
59. Maltez A.C. 1997. As percentagens sexuais de Panonychus ulmi (Koch, 1836) (Acari: Tetranychidae) em populações criadas no laboratório. Agronomia Lusitana 46: 47-51.
60. Maltez A.C., Carmona M.M. 1980. Preferências alimentares do Panonychus ulmi (Koch) (Acarina: Tetranychidae) em pereira. In: Actas do I Congresso Português de Fitiatria e Fitofarmacologia, Lisboa: 117-126.
61. Marić I., Marčić D., Petanović R., Auger P. 2018. Biodiversity of spider mites (Acari: Tetranychidae) in Serbia: a review, new records and key to all known species. Acarologia, 58: 3-14. doi:10.24349/acarologia/20184223
62. Marić I., Međo I., Marčić D., Petanović R., Jovanović S., Ueckermann E.A. 2021. Spider mites (Acari: Tetranychidae) from Serbia: new species for the country and the Balkan Peninsula, with a key to all known Serbian species. Systematic and Applied Acarology, 26: 304-316. doi:10.11158/saa.26.1.17
63. Matsuda T., Fukumoto C., Hinomoto N., Gotoh T. 2013. DNA-Based identification of spider mites: molecular evidence for cryptic species of the Genus Tetranychus (Acari: Tetranychidae). Journal of Economic Entomology, 106 (1): 463-472. doi:10.1603/EC12328
64. Migeon A., Dorkeld F. 2020. Spider Mites Web: a comprehensive database for the Tetranychidae. (Internet). (05 December 2020). Montpellier: INRA/CBGP. Available from http://www1.montpellier.inra.fr/CBGP/spmweb .
65. Migeon A., Ferragut F., Escudero-Colomar L.A., Fiaboe K., Knapp M., de Moraes G.J., Ueckermann E., Navajas M. 2009. Modelling the potential distribution of the invasive tomato red spider mite, Tetranychus evansi (Acari: Tetranychidae). Experimental and Applied Acarology, 48: 199-212. doi:10.1007/s10493-008-9229-8
66. Migeon A., Malagnini V., Duso C., Navajas M., 2007. Notes on the genus Eotetranychus (Acari: Tetranychidae) in Italy and France with a redescription of Eotetranychus fraxini Reck, new record for Italy and Western Europe. Zootaxa, 1509: 51-60. doi:10.11646/zootaxa.1509.1.5
67. Mirza J.H., Kamran M., Saleh A.A., Alatawi F.J., 2020. Molecular and phenotypic variations in Eutetranychus orientalis (Klein) populations from Saudi Arabia. PLoS ONE 15(5): e0233389. doi:10.1371/journal.pone.0233389
68. Navajas M., Migeon A., Estrada-Peña A., Mailleux A.-C., Servigne P., Petanović R. 2010. Mites and ticks (Acari). Chapter 7.4. In: Roques A. et al. (Eds). Arthropod invasions in Europe. BioRisk 4: 149-192. doi:10.3897/biorisk.4.58
69. Neves M.M. 2012. Conversão para viticultura biológica (Masters Thesis). Viana do Castelo: Tese de mestrado em Agricultura Biológica, Escola Superior Agrária do Instituto Politécnico de Viana do Castelo. pp. 157.
70. Norambuena H., Martinez G., Carrillo R., Neira M., 2007. Host specificity and establishment of Tetranychus lintearius (Acari: Tetranychidae) for biological control of gorse, Ulex europaeus (Fabaceae) in Chile. Biological Control, 40: 204-212. doi:10.1016/j.biocontrol.2006.08.012
71. Pereira M.M. 2004. Prejuízos causados por ácaros fitófagos na cultura do milho (PhD Thesis). Lisboa: Tese de Doutoramento em Engenharia Agronómica, Universidade Técnica de Lisboa, Instituto Superior de Agronomia. pp. 342.
72. Pereira N., Ferreira M.A. S., Sousa M.E., Franco J.C. 2006. Mites, lemon trees and ground cover interactions in Mafra region. IOBC/WPRS Bulletin, 29: 143-150.
73. Pina S., Ferreira M.A.S., Calha I.M., Figueiredo E. 2012. Os ácaros na cultura da amora em estufa e infestantes. In: Actas do V Colóquio Nacional da Produção de Pequenos Frutos, Actas Portuguesas de Horticultura nº 26: 69-76.
74. Rodrigues R. 2012. Pragas Principais da Videira. In: Pereira A.N., Rego C., Oliveira H., Portugal J., Sofia J., Bugaret Y., Vidal R., Rodrigues R (Eds). Manual Bayvitis: A fitossanidade da videira. Lisboa: Bayer CropScience. pp. 301.
75. Rodrigues I., Bento A., Pereira J.A. 2018. Monitorização das populações de aranhiço-amarelo Tetranychus urticae (Koch), em pomares de amendoeira no norte de Portugal. In: 4º Simpósio Nacional de Fruticultura. Faro. p. 93.
76. Ros V., Breeuwer J., Menken S., 2008. Origins of asexuality in Bryobia mites (Acari: Tetranychidae). BMC Evolutionary Biology, 8: 153. doi:10.1186/1471-2148-8-153
77. Santos P.M. 2011. Acarofauna da vinha e infestantes em zonas edafoclimáticas diferentes na Região de Setúbal (Masters Thesis). Tese de Mestrado em Engenharia Agronómica, Universidade Técnica de Lisboa, Instituto Superior de Agronomia, pp. 62.
78. Santos P.M., Ferreira M.A. 2016. Acarofauna da vinha e infestantes na região de Setúbal. Livro de atas do 10º Encontro Nacional de Proteção Integrada, Maio 2014. Instituto Politécnico de Beja. pp. 112-121.
79. Smith F.F., Baker E.W. 1968. Names of the two-spotted spider mite and the carmine spider mite to be redesignated. Cooperative Economic Insect Report, 18: 1080
80. Sobreiro J.B. 1993. O combate aos ácaros da macieira e pereira na perspectiva da protecção integrada. Revista de Ciências Agrárias, 16: 49-62.

instructions